View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_43 (Length: 280)
Name: NF0594_low_43
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 72 - 226
Target Start/End: Complemental strand, 757638 - 757489
Alignment:
| Q |
72 |
catgaacgaataaagactttatctatatgagtcacaagtggttcgtgaaatacctaactcgttcgtgtgctttcataacgaaaactcttacaaaaaaggt |
171 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
757638 |
catgaacgaataaagac---atc--tatgagtcacaagtggttcgtgaaatacctaactcgttcgtgtgctttcataacgaaaactcttacaaaaaaggt |
757544 |
T |
 |
| Q |
172 |
ttcttatgtataaagagagctaatgcaagagaaagttcaagtgacacgatttaga |
226 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
757543 |
ttcttatgtataaagagaggtaatgcaagagaaagttcaagtgacacgatttaga |
757489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University