View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_46 (Length: 263)
Name: NF0594_low_46
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0594_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 30 - 198
Target Start/End: Complemental strand, 27220082 - 27219914
Alignment:
Q |
30 |
gcacaagctatcaaaagagcaaaacctatggtatgtatgaattgaatgttatatattataatagttgtagtaaactattttagattaaacaaattaaaag |
129 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
27220082 |
gcacaggctatcaaaagagcaaaacctatggtatgtatgaattgaatgttatatattataatagttgtagtaaactattttagattaaacaaattaaagg |
27219983 |
T |
 |
Q |
130 |
tgtgtctggtgtctgagatgtatctatagatgacactcacacacatatatagttacattcaatcacttt |
198 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
T |
27219982 |
cgtgtctggtgtctgacatgtatctatagatgacactcacacacacatatggttacattcaatcacttt |
27219914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 159 - 263
Target Start/End: Complemental strand, 27219913 - 27219809
Alignment:
Q |
159 |
atgacactcacacacatatatagttacattcaatcacttttatgttttcaaattattacttgtattaatttcatgtctggtgtcggtatgaacatttcat |
258 |
Q |
|
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27219913 |
atgacactcacacacacatatggttacattcaatcacttttatgttttcaaattgttacttgtattaatttcatgtctggtgtcggtatgaacatttcat |
27219814 |
T |
 |
Q |
259 |
aggta |
263 |
Q |
|
|
||||| |
|
|
T |
27219813 |
aggta |
27219809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 8013854 - 8013891
Alignment:
Q |
181 |
gttacattcaatcacttttatgttttcaaattattact |
218 |
Q |
|
|
||||||||||||||||| ||| |||||||||||||||| |
|
|
T |
8013854 |
gttacattcaatcacttatattttttcaaattattact |
8013891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1177 times since January 2019
Visitors: 3841