View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_51 (Length: 228)
Name: NF0594_low_51
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 69 - 131
Target Start/End: Original strand, 29175523 - 29175585
Alignment:
| Q |
69 |
gttatcaaacttcctcatgctcgaaccattgcatgccctcgagcaattagtgatgcaggaggg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29175523 |
gttatcaaacttcctcatgctcgaaccattgcatgccctcgaacaattagtgatgcaggaggg |
29175585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University