View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0594_low_52 (Length: 212)

Name: NF0594_low_52
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0594_low_52
NF0594_low_52
[»] chr4 (1 HSPs)
chr4 (27-85)||(6909890-6909948)


Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 6909948 - 6909890
Alignment:
27 caaaggttattaaagacgtgtatattccctcttgaacttaccttgcaaaacaacaaatg 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6909948 caaaggttattaaagacgtgtatattccctcttgaacttaccttgcaaaacaacaaatg 6909890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University