View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_7 (Length: 568)
Name: NF0594_low_7
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 95 - 312
Target Start/End: Complemental strand, 53678258 - 53678039
Alignment:
| Q |
95 |
acatgtttggaagctagttgatgaattatgaaactaatgtcgttatagcttaaacttcataaagttttgtcaaatcaataaaattaataacaacttcgtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53678258 |
acatgtttggaagctagttgatgaattatgaaacttatgtcgttatagcttaaacttcataaagttttgtcaaatcaataaaattaataacaacttcgtt |
53678159 |
T |
|
| Q |
195 |
gcaaatattgaagtgtcccttcaatactgctcatatggatgaatgggtgtaaacatattatttattg-attcattta-tttttgtgtcaaattatttatt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
53678158 |
gcaaatattgaagtgtcccttcaatactgctcatatggatggatgggtgtaaacatattatttattgaattcatttattttttttgtcaaattatttatt |
53678059 |
T |
|
| Q |
293 |
gactcataaatgttacttct |
312 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53678058 |
gactcataaatgttacttct |
53678039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 148; E-Value: 8e-78
Query Start/End: Original strand, 313 - 489
Target Start/End: Complemental strand, 53678011 - 53677835
Alignment:
| Q |
313 |
atttttggtagcagcaacccctactatatcatttcatggctgcacatgttcatgnnnnnnnatatactctgaattgaaaaatcagcataataatttaaca |
412 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53678011 |
atttttggtagcagcaacccctactatctcatttcatggcagcacatgttcatgtttttttatatactctgaattgaaaaatcagcataataatttaaca |
53677912 |
T |
|
| Q |
413 |
aatctttaagtgaaagttgcacatgctcataaggcaattcttattctggaagctataaatggattttgaatattctt |
489 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53677911 |
aatctttaagtgaaagttgcacatgctcataaggcaattcttattctggaagctataaatggattttgaatattctt |
53677835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 206 times since January 2019
Visitors: 3831