View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0595_high_3 (Length: 497)
Name: NF0595_high_3
Description: NF0595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0595_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 4 - 408
Target Start/End: Complemental strand, 19549782 - 19549378
Alignment:
| Q |
4 |
gaggttcttattgttccagagaccgattctggttcgaataatgtatgtattggtgatacaaagtttatacccgatcttcgggttctggttcatccttatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| | |
|
|
| T |
19549782 |
gaggttcttattgttccagagaccgattctggtttgaataatgtatgtattggtgatacaaagtttatacccgatcttcaggttttggttcatccttact |
19549683 |
T |
 |
| Q |
104 |
tgccacctatggtggctagtctttcattgataagtgattatatagatggaagaattcgaaatgggtttagaccgaaagctttatgccttggggttggagg |
203 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19549682 |
taggacctatggtggctagtctttcattgataagtgattatatagatggaagaattcgaaatgggtttagaccgaaagctttatgccttggggttggagg |
19549583 |
T |
 |
| Q |
204 |
tggggctttgttaacttttctggcaattcagttgggttttgaggtcgtcggtgttgatagtgataacgaggttttgaaggtggcaaaaaactactttgga |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19549582 |
tggggctttgttaacttttctggcaattcagttgggttttgaggtcgtcggtgttgatagtgataacgaggttttgaaggtggcaaaaaactactttgga |
19549483 |
T |
 |
| Q |
304 |
ttggaagactctgaatttattcgtgttattgttgcagatgctgttaaatatatgaagaaacttgctgaccgtggaaaacaatgcagtaagagttcttttg |
403 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19549482 |
ttggaagactctgaatttattcgtattattgttgcagatgctgttaaatatatgaagaaacttgctgaccgtggaaaacaatgcagtaagagttctttta |
19549383 |
T |
 |
| Q |
404 |
atgat |
408 |
Q |
| |
|
||||| |
|
|
| T |
19549382 |
atgat |
19549378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University