View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0595_low_11 (Length: 309)
Name: NF0595_low_11
Description: NF0595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0595_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 84 - 211
Target Start/End: Original strand, 4134144 - 4134271
Alignment:
| Q |
84 |
agatgaataatgaaaagaggttagattagaggaatatgaagaagggtacctgagaattgatgctttgaaggtttgggtttgaattcatcaaaatccaaca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4134144 |
agatgaataatgaaaagaggttagattagaggaatatgaagaagggtacctgagaattgatgctttgaaggtttgggtttgaattcatcaaaatccaaca |
4134243 |
T |
 |
| Q |
184 |
aaagagttatacaagataatgttaaaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4134244 |
aaagagttatacaagataatgttaaaag |
4134271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University