View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0595_low_13 (Length: 283)
Name: NF0595_low_13
Description: NF0595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0595_low_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 283
Target Start/End: Complemental strand, 50141169 - 50140918
Alignment:
| Q |
29 |
aaagagatggcaaaatagcatcaaagaaagcatatttgattagagcattgaatttgtcttgtctaaccaaagttagataccaaggacgtgtacgtgtgtg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141169 |
aaagagatggcaaaatagcatcaaagaaagcatatttgattagagcattaaatttgtcttgtctaaccaaagttagataccaaggacgtgtacgtgtgtg |
50141070 |
T |
|
| Q |
129 |
taattgttaattcatacttcttcgattagagttatagaataaatgccnnnnnnnnnnnnaaccaaccatattgatctatgaatgtgtgagacgagtttgc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141069 |
taattgttaattcatacttcttcgattagagttatagaataaatgac---tttttttttaaccaaccatattgatctatgaatgtgtgagacgagtttgc |
50140973 |
T |
|
| Q |
229 |
tatagttcacggatatatcaaaattttaaacacatcttaaaatatatatttgatt |
283 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
50140972 |
tatagttcacggatgtatcaaaattgtaaacacatttttaaatatatatttgatt |
50140918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University