View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0595_low_16 (Length: 201)
Name: NF0595_low_16
Description: NF0595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0595_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 9e-35; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 30878647 - 30878565
Alignment:
| Q |
1 |
catgcatggacaaattaagctagaatctctttagatatctagctctagtatatcaccataatatgtggctttttattcgtaac |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30878647 |
catgcatggacaaattaagctagaatctctttagatagctagctctagtttatcaccataatatgtggctttttattcgtaac |
30878565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 30854448 - 30854384
Alignment:
| Q |
1 |
catgcatggacaaattaagctagaatctctttagatatctagctctagtatatcaccataatatgtg |
67 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| | |||||| |||| ||||||||||||||||| |
|
|
| T |
30854448 |
catgcatggacaaattaagctggaatct--ttagacagctagctttagtctatcaccataatatgtg |
30854384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 100 - 131
Target Start/End: Complemental strand, 30878554 - 30878523
Alignment:
| Q |
100 |
ccttcttttctgttttgaatttggttggttat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30878554 |
ccttcttttctgttttgaatttggttggttat |
30878523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 15064233 - 15064297
Alignment:
| Q |
1 |
catgcatggacaaattaagctagaatctctttagatatctagctctagtatatcaccataatatgtg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| | | | |||||||||||||||| |||||||||||| |
|
|
| T |
15064233 |
catgcatggacaaattaagctagaatctc--tcaacaactagctctagtatatctccataatatgtg |
15064297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 15070955 - 15070984
Alignment:
| Q |
1 |
catgcatggacaaattaagctagaatctct |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15070955 |
catgcatggacaaattaagctagaatctct |
15070984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University