View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0595_low_8 (Length: 378)
Name: NF0595_low_8
Description: NF0595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0595_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 12 - 349
Target Start/End: Original strand, 28840242 - 28840579
Alignment:
| Q |
12 |
atgaagatcaattgaagtcagaatttggagctacaatacaactttaccaacacaaaacttttatcaccaaagaagcatcatcaatgaagttccaattctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28840242 |
atgaagatcaattgaagtcagaatttggagatacaatacaactttacccacacaaaacttttatcaccaaagaagcatcatcaatgaagttccaattctt |
28840341 |
T |
 |
| Q |
112 |
cattgttccatttcttcttctaagcatcatatcatcactctttaacttgactctagctgacttaatctcagacaaatattctctccttgaattctcttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28840342 |
cattgttccatttcttcttctaagcatcatatcatcactctttaacttgactctagctgacttaatctcagataaatattctctccttgaattctcttct |
28840441 |
T |
 |
| Q |
212 |
actcttccacatgccttaagattgaactggaataactctactcctatttgcacttcatggattggcataacttgcaaccaaaatgaaactaatgtcataa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28840442 |
actcttccacatgccttaagattgaactggaataactctactcctatttgcacttcatggattggcataacttgcaaccaaaatgaaactaatgtcataa |
28840541 |
T |
 |
| Q |
312 |
gcatccatcttccgggaattggattaaagggtgccatt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28840542 |
gcatccatcttccgggaattggattaaagggtgccatt |
28840579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University