View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0596_low_1 (Length: 716)
Name: NF0596_low_1
Description: NF0596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0596_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 8e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 8e-66
Query Start/End: Original strand, 17 - 171
Target Start/End: Complemental strand, 5806401 - 5806246
Alignment:
| Q |
17 |
taataaacatgcacttatcccaatggatgttgcaatggctgtcgaatccaaatttgcaggttacaaaattatttagtcgatctttatggactatttggaa |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||| |
|
|
| T |
5806401 |
taataaacatgcacttatcccaacggatgttgcaatggctgtcgaatccaaatttgcaggttacacaattatttagtctatctttatggactatttagaa |
5806302 |
T |
 |
| Q |
117 |
aatgagaaatgatgtagttttcaac-acaaaagttccaaaccttatgcttgctgtt |
171 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
5806301 |
aatgagaaatgatgtagttttcaacaaaaaaagttccaaaccttatgcttgctgtt |
5806246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 551 - 606
Target Start/End: Original strand, 39488882 - 39488937
Alignment:
| Q |
551 |
ttgaaattgagttcattgttgctgactgtttagatattttgtttagtttattaaat |
606 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
39488882 |
ttgaaattgatttcattattgttgactgtttagacattttggttagtttattaaat |
39488937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 551 - 614
Target Start/End: Original strand, 46035004 - 46035067
Alignment:
| Q |
551 |
ttgaaattgagttcattgttgctgactgtttagatattttgtttagtttattaaatgttagtgt |
614 |
Q |
| |
|
|||||||||| || ||| ||| |||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
46035004 |
ttgaaattgattttattattgttgactgtttagacattttagttagtttattaaatgtaagtgt |
46035067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University