View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0596_low_3 (Length: 477)
Name: NF0596_low_3
Description: NF0596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0596_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 4e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 95 - 257
Target Start/End: Original strand, 24941837 - 24941999
Alignment:
| Q |
95 |
aaatagaccttctgatgtctggacatccaccccagtctgaatcattctaaaagataaacttattgatggaggaaggatacatgtgcaggctgggatcaat |
194 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24941837 |
aaatagaccttttgatgtctggacatccaccccagtctgaatcattgtaaaagataagcttattgatggaggaaggatacacgtgaaggctgggatcaat |
24941936 |
T |
|
| Q |
195 |
aatgccctgaatatagtgaatgatgcgcttcaatgccgacatatgttgtatttttggattacg |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24941937 |
aatgccctgaatatagtgaatgacgcgcttcaatgccgacatatgttgtgtttttggattacg |
24941999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1933 times since January 2019
Visitors: 3810