View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0596_low_6 (Length: 324)
Name: NF0596_low_6
Description: NF0596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0596_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 35417447 - 35417197
Alignment:
Q |
1 |
catcaccaatgacccacaagacataacaaccattgtctcaaattctaattccaacattgtttctcataactcattagatatgttgaaaaatttgaaggtg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35417447 |
catcaccaatgacccacaagacataacaaccattgtctcaaattctaattccaacgttgtttctcataactcattagatatgttgaaaaatttgaaggtg |
35417348 |
T |
 |
Q |
101 |
tttgtttatgagctaccttcaaaatacaacaatgattggcttgtaaatgggaggtgtaaaacacatttgtttgcttcagaagttgctattcacaccgcat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35417347 |
tttgtttatgagctaccttcaaaatacaacaatgattggcttgtaaatgggaggtgtaaaacacatttgtttgcttcagaagttgctattcacaccgcat |
35417248 |
T |
 |
Q |
201 |
tgttgaaaagtgatgtgagaacttttgacccttatgaagctgatttcttct |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35417247 |
tgttgaaaagtgatgtgagaacttttgacccttatgaagctgatttcttct |
35417197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 12172910 - 12172867
Alignment:
Q |
208 |
aagtgatgtgagaacttttgacccttatgaagctgatttcttct |
251 |
Q |
|
|
||||||||| ||||||||||||||||| ||||||||||| |||| |
|
|
T |
12172910 |
aagtgatgttagaacttttgacccttacgaagctgattttttct |
12172867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 251
Target Start/End: Original strand, 21056021 - 21056114
Alignment:
Q |
158 |
aaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtgatgtgagaacttttgacccttatgaagctgatttcttct |
251 |
Q |
|
|
||||| ||||| ||||||||||||||||||||||| | || || || | ||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
T |
21056021 |
aaaactcatttatttgcttcagaagttgctattcatagagctttattaacaagtgatgtaagaacttttgacccatatgaagctgattttttct |
21056114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University