View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0598-INSERTION-15 (Length: 327)

Name: NF0598-INSERTION-15
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0598-INSERTION-15
NF0598-INSERTION-15
[»] chr6 (2 HSPs)
chr6 (186-279)||(10819176-10819269)
chr6 (294-327)||(10819125-10819158)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 186 - 279
Target Start/End: Complemental strand, 10819269 - 10819176
Alignment:
186 ggactcaagtatttgcttgagaaacttcgtgaaccctctttgatattgcatattttataagttatatagcttaagttttcaagtaactcgttct 279  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
10819269 ggactcaagtatttgcttgagaaacttcgtgaacactctttgatattgcatattttataaattatatagcttaagttttcaagtaacttgttct 10819176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 327
Target Start/End: Complemental strand, 10819158 - 10819125
Alignment:
294 gttttcaagtaactctgaatgtggtgcgctgaat 327  Q
    ||||||||||||||||||||||||||||||||||    
10819158 gttttcaagtaactctgaatgtggtgcgctgaat 10819125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University