View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598-INSERTION-15 (Length: 327)
Name: NF0598-INSERTION-15
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598-INSERTION-15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 186 - 279
Target Start/End: Complemental strand, 10819269 - 10819176
Alignment:
| Q |
186 |
ggactcaagtatttgcttgagaaacttcgtgaaccctctttgatattgcatattttataagttatatagcttaagttttcaagtaactcgttct |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
10819269 |
ggactcaagtatttgcttgagaaacttcgtgaacactctttgatattgcatattttataaattatatagcttaagttttcaagtaacttgttct |
10819176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 327
Target Start/End: Complemental strand, 10819158 - 10819125
Alignment:
| Q |
294 |
gttttcaagtaactctgaatgtggtgcgctgaat |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10819158 |
gttttcaagtaactctgaatgtggtgcgctgaat |
10819125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University