View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598-INSERTION-17 (Length: 656)
Name: NF0598-INSERTION-17
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598-INSERTION-17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 370; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 133 - 586
Target Start/End: Original strand, 43756078 - 43756534
Alignment:
| Q |
133 |
acctttcgtcactcactatgttcaatccggaaccccaattctcctccagatccaggtaacaaaaacagagcacaccataattttattctcttaaaaattt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43756078 |
acctttcgtcactcactatgttcaatccggaaccccaattctcctccagatccaggtaacaaaaacagagcgcaccataattttattctcttaaaaattt |
43756177 |
T |
|
| Q |
233 |
catattttcgatgtttttgttgtaaatgctgacnnnnnnnnnnnnnnnng--aatttttgggttatgcagagttacagggctggatatcttgatgctatt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43756178 |
catattttcgatgtttttgttgtaaatgctgacttttttttttttttttttaaatttttgggttatgcagagttacagggctggatatcttgatgctatt |
43756277 |
T |
|
| Q |
331 |
ttttctggcttgtcttgcgttgtttctgtgccattttacactgcttttatccctatgttattctgggtatgtataatttaatgatattatacaaagtttt |
430 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
43756278 |
ttttctggcttgtcttgtgttgtttctgtgccattttacactgcttttatccctatgttattctgggtatgtataatttgatgatattatacaaaatttt |
43756377 |
T |
|
| Q |
431 |
gagtaaaaaactgtaaatttattggaatttggcttctgtgtagagtggtcatggtcaattggctaggcagatgacgttgttgatggcgttttgtgattat |
530 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43756378 |
gagtaaaaaactgtaaatttattggaatttggcttctgtgtagagtggtcatggtcaattggctaggcagatgacgttgttgatggcgttttgtgattat |
43756477 |
T |
|
| Q |
531 |
atagggaactgtataaaggtgtgtatgtttgttttgaatca-aatttgattcaacac |
586 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43756478 |
atagggaactgtataaaggtgtgtatgtttgttttgaatcagaatttgattcaacac |
43756534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 43755953 - 43756013
Alignment:
| Q |
8 |
ataataacaagaacaaaaatggaaaattcatcactttggcaaggtgcgattcttggtggaa |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755953 |
ataataacaagaacaaaaatggaaaattcatcactttggcaaggtgcgattcttggtggaa |
43756013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3110 times since January 2019
Visitors: 3831