View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598-INSERTION-3 (Length: 448)
Name: NF0598-INSERTION-3
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598-INSERTION-3 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 4e-73; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 186 - 448
Target Start/End: Complemental strand, 36131016 - 36130754
Alignment:
| Q |
186 |
cctttttgcgttaagggaattggaaggagatgaataggacggatgggccaatttgannnnnnnnnnnnnngtttaaaatggggtaactttgtaatttcct |
285 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36131016 |
cctttttgcgttaagggaatcggaaggagatgaataggatggatgggccaatttgattttttttttttt-gtttaaaatggggtaactttgtaatttcct |
36130918 |
T |
 |
| Q |
286 |
ccacgtnnnnnnntttataaaagaaaattggggtcagccgcggttctatccgatttgaaggattggtatgtgtattccggatgttcatcccgtaactcaa |
385 |
Q |
| |
|
| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
36130917 |
cgatgtaaaaaaaattataaaagaaaattggggtcagccgcggttctatccgatttgaaggattggtatgtgtatttcggatgttcatcccgtaacttaa |
36130818 |
T |
 |
| Q |
386 |
accagtcaagctacggatgtctacgtatgtgagggacc-aaatgattgatattttggtaaccca |
448 |
Q |
| |
|
| ||||| |||||| ||||||||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
36130817 |
atcagtcgagctacagatgtctacatatgtgaggggccaaaatgattgatattttggtaaccca |
36130754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 64 - 101
Target Start/End: Complemental strand, 36131138 - 36131101
Alignment:
| Q |
64 |
ttagtactcaacatatttacctttaactcccaattgga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36131138 |
ttagtactcaacatatttacctttaactcccaattgga |
36131101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 444
Target Start/End: Original strand, 36130456 - 36130535
Alignment:
| Q |
366 |
atgttcatcccgtaactcaaaccagtcaagctacggatgtctacgtatgtgagggacc-aaatgattgatattttggtaa |
444 |
Q |
| |
|
|||||||||| ||||||||||||| || | |||| |||||| || || |||||||||| |||||| ||||| |||||||| |
|
|
| T |
36130456 |
atgttcatccggtaactcaaaccaatcgaactaccgatgtccacataagtgagggaccaaaatgaatgatactttggtaa |
36130535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 365 - 444
Target Start/End: Original strand, 43224632 - 43224712
Alignment:
| Q |
365 |
gatgttcatcccgtaactcaaaccagtcaagctacggatgtctacgtatgtgagggaccaaa-tgattgatattttggtaa |
444 |
Q |
| |
|
||||||||||| |||||||||| | || | |||| |||||| || || | ||||||||||| |||||||||||||||||| |
|
|
| T |
43224632 |
gatgttcatcctgtaactcaaaatattcgaactacagatgtccacataggcgagggaccaaaatgattgatattttggtaa |
43224712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University