View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598-INSERTION-4 (Length: 357)
Name: NF0598-INSERTION-4
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598-INSERTION-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 4e-94; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 4188233 - 4188012
Alignment:
| Q |
8 |
ggaatatcagtggaatttgtcaacaactgtttatatgaggaatgagttaagttttttaatttctcctattctcttatgccttcaagacaacaactgttta |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4188233 |
ggaatatcagtggaatttgttaacaactgtttatatgaggaatgagttaagttttttaatttctcatattctcttatgccttcaggacaacaactgttta |
4188134 |
T |
 |
| Q |
108 |
ggcgatttccttgtcaacttatgcaccctttaccaagtatgtgagcagaccagtaacctgaagtgtgtga--tctccttggaaagtagtggcatgtgcca |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
4188133 |
ggcgatttccttgtcaacttattcaccctttaccaagtatgtgagcagaccggtaacctgaatcgtgtgatctctccttggaaagtagtggcatgtgccg |
4188034 |
T |
 |
| Q |
206 |
aataagagaagaacgggtcttg |
227 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
4188033 |
aataagagaagaatgggtcttg |
4188012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 223 - 259
Target Start/End: Complemental strand, 4187670 - 4187634
Alignment:
| Q |
223 |
tcttgggttgaaaaacatttcaaatatcttgaagagt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4187670 |
tcttgggttgaaaaacatttcaaatatcttgaagagt |
4187634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 308 - 340
Target Start/End: Complemental strand, 4187632 - 4187600
Alignment:
| Q |
308 |
tagaatccaaggggtacaattgatgtcctagta |
340 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
4187632 |
tagaatccaaggggtacaattgatgtcccagta |
4187600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University