View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_19 (Length: 407)
Name: NF0598_high_19
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 244 - 391
Target Start/End: Complemental strand, 40520029 - 40519882
Alignment:
| Q |
244 |
agcggaagttaagtaaagtaaaaaggaagtatttttgcatgatatgacatacacatgcacggttatacctaagatccaataacaacctcaatggaaatat |
343 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520029 |
agcggaagttaagtaaagtaaaaaggaggtatttttgcatgatatgacatacacatgcacggttatacctaagatccaataacaacctcaatggaaatat |
40519930 |
T |
 |
| Q |
344 |
aggggacaaccccctttcccccaaacataattttcaattcacttctaa |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519929 |
aggggacaaccccctttcccccaaacataattttcaattcacttctaa |
40519882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 30 - 177
Target Start/End: Complemental strand, 40520243 - 40520096
Alignment:
| Q |
30 |
ttaccaagtctccaactgctgaaagttgaaacgtaaaagataagttgaagcagcgaggttgcatgcatgcatacatgctgctattgctgcgctaatatta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520243 |
ttaccaagtctccaactgctgaaagttgaaacgtaaaagataagttgaagcagcgaggttgcatgcatgcatacatgctgctattgctgcgctaatattg |
40520144 |
T |
 |
| Q |
130 |
gtgattgtgtgttgacaattcaacgaccatgtttggccagaaatggat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520143 |
gtgattgtgtgttgacaattcaacgaccatgtttggccagaaatggat |
40520096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University