View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_25 (Length: 379)
Name: NF0598_high_25
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 98 - 365
Target Start/End: Complemental strand, 41659478 - 41659216
Alignment:
| Q |
98 |
agttttcaccttcagacttgagagatttatggtcatgtttattgaattcttttgttcttctcaacttttcccgcttcttgttttcatgattttccaaata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41659478 |
agttttcaccttcagacttgagagatttatggccatgtttattgaattcttttgttcttctcaacttttcccgcttcttgttttcatgattttccaaata |
41659379 |
T |
 |
| Q |
198 |
tttgattatgcgagattattattgaatcttggttatttttacttcatattcaagtaaaataatacatagacttcaagaaatccatgaacactgaactgaa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41659378 |
tttgattatgcgagattattattgaatcttggttatttttacttcatattcaagtaaaataatacatagacttcaagaaatccatgaacac-----tgaa |
41659284 |
T |
 |
| Q |
298 |
aaggttagtagttttagaaattaggttagtgtaccaatttggttttactaaactactttgtctttagt |
365 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41659283 |
aaggttagtagttttagaatttaggttagtgtaccaatttggttttactaaactactttgtctttagt |
41659216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 41658309 - 41658252
Alignment:
| Q |
296 |
aaaaggttagtagttttagaaattaggttagtgtaccaatttggttttactaaactac |
353 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
41658309 |
aaaaggttagtagattcagaaattaggttagtgtgccaatttggttgtactaaactac |
41658252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University