View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_37 (Length: 330)
Name: NF0598_high_37
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 210 - 322
Target Start/End: Complemental strand, 8764666 - 8764557
Alignment:
Q |
210 |
cccacggactagagacgaactcgataaatattattacacttcccacaagtttcttgatttaattaatttctctatttctaacaattttacacataatttt |
309 |
Q |
|
|
||||| ||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
T |
8764666 |
cccacagactataggcgagctcgataaatattattacacttcccacaagtttcttgatttaattaatttctc---ttctaacaattttacagataatttt |
8764570 |
T |
 |
Q |
310 |
ttctcctatgcta |
322 |
Q |
|
|
||||||| ||||| |
|
|
T |
8764569 |
ttctcctttgcta |
8764557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 95 - 142
Target Start/End: Complemental strand, 8764789 - 8764742
Alignment:
Q |
95 |
agaagaatgggacttcgctcctaccggcagcctagatacttcaaagga |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8764789 |
agaagaatgggacttcgctcctaccggcagcctagatacttcaaagga |
8764742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 163 - 214
Target Start/End: Complemental strand, 8764740 - 8764690
Alignment:
Q |
163 |
aagaaatccctccgccatcctaagaaaaagagttgtctacatgaacccccac |
214 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
8764740 |
aagaaatccctccgccatcctaag-aaaagagttgtctacatgaacccccac |
8764690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2811 times since January 2019
Visitors: 3829