View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_47 (Length: 309)
Name: NF0598_high_47
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 123 - 235
Target Start/End: Complemental strand, 51294784 - 51294674
Alignment:
| Q |
123 |
ttattttgatattcaatgtcattgtaatcatattagtataccctatccatctctttgtgtgcgagtgctacaatacatgcaatatcaaagggaaaagaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294784 |
ttattttgatattcaatgtcattgtaatcatattagta--ccctatccatctctttgtgtgcgagtgctacaatacatgcaatatcaaagggaaaagaaa |
51294687 |
T |
|
| Q |
223 |
gaactagaccacc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51294686 |
gaactagaccacc |
51294674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 51294909 - 51294866
Alignment:
| Q |
1 |
accaaaataaaacaagacggagttgttacataataaaatattgg |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294909 |
accaaaataaaacaagacggagttgttacataataaaatattgg |
51294866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1121 times since January 2019
Visitors: 3840