View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0598_high_48 (Length: 309)

Name: NF0598_high_48
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0598_high_48
NF0598_high_48
[»] chr6 (3 HSPs)
chr6 (83-222)||(14593106-14593245)
chr6 (83-222)||(13308326-13308463)
chr6 (50-89)||(14595485-14595524)
[»] chr5 (2 HSPs)
chr5 (103-219)||(6837779-6837895)
chr5 (136-200)||(34915885-34915949)
[»] chr3 (1 HSPs)
chr3 (103-219)||(22598549-22598665)
[»] chr7 (3 HSPs)
chr7 (103-219)||(22347989-22348105)
chr7 (83-197)||(21281843-21281957)
chr7 (136-200)||(17859863-17859927)
[»] chr1 (1 HSPs)
chr1 (103-217)||(16000914-16001028)
[»] chr4 (1 HSPs)
chr4 (136-200)||(4968394-4968458)
[»] chr8 (1 HSPs)
chr8 (103-216)||(306589-306702)


Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 83 - 222
Target Start/End: Complemental strand, 14593245 - 14593106
Alignment:
83 aaaatgaagtatgatattcagttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggagg 182  Q
    ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
14593245 aaaatgaagtatgatatccagttttggcagcaatggttacagattgtttggccacatcggtgtcaactgttgcttctgaaagcgcatttagcactggagg 14593146  T
183 aagagttttagacacatacaggagctccttgagtccgaca 222  Q
    |||||||||||||||||| ||||| |||||||||||||||    
14593145 aagagttttagacacatataggagttccttgagtccgaca 14593106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 83 - 222
Target Start/End: Original strand, 13308326 - 13308463
Alignment:
83 aaaatgaagtatgatattcagttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggagg 182  Q
    |||||||||| |||||| ||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||| ||||||||||||||||    
13308326 aaaatgaagtctgatatccagttttggcagcaatggttagagattgtttggcggtg--ggtgtcaactgttgcttctgaaagcacatttagcactggagg 13308423  T
183 aagagttttagacacatacaggagctccttgagtccgaca 222  Q
    |||||||||||||||||| ||||||||||||| |||||||    
13308424 aagagttttagacacatataggagctccttgaatccgaca 13308463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 89
Target Start/End: Complemental strand, 14595524 - 14595485
Alignment:
50 aacatttgaaaacaaaggaaaccattgttcaacaaaatga 89  Q
    ||||||||||||||||||||||||||||||||||||||||    
14595524 aacatttgaaaacaaaggaaaccattgttcaacaaaatga 14595485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 6837895 - 6837779
Alignment:
103 gttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacataca 202  Q
    ||||||||| ||||||||||||||   ||||||||||| || ||| | |||||||| || |||||||||||||| ||||||||  ||||||||||||| |    
6837895 gttttggcaacaatggttagagatgtgttggccacaccagtatcatcagttgcttcggagagcgcatttagcaccggaggaaggattttagacacatata 6837796  T
203 ggagctccttgagtccg 219  Q
    ||||||| |||||||||    
6837795 ggagctcattgagtccg 6837779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 200
Target Start/End: Original strand, 34915885 - 34915949
Alignment:
136 acaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacata 200  Q
    ||||| || |||||||| ||||||||||| || |||||||||||||||||||||||||| |||||    
34915885 acaccagtttcaactgtggcttctgaaagtgcctttagcactggaggaagagttttagatacata 34915949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 22598549 - 22598665
Alignment:
103 gttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacataca 202  Q
    ||||||||| ||||||||||||||   ||||||||||| || ||| | |||||||| || |||||||||||||| ||||||||  ||||||||||||| |    
22598549 gttttggcaacaatggttagagatgtgttggccacaccagtatcatcagttgcttcggagagcgcatttagcaccggaggaaggattttagacacatata 22598648  T
203 ggagctccttgagtccg 219  Q
    ||||||| |||||||||    
22598649 ggagctcattgagtccg 22598665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 22347989 - 22348105
Alignment:
103 gttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaa-agcgcatttagcactggaggaagagttttagacacatac 201  Q
    ||||||||| ||||||||||||||   ||||||||||| || ||| | ||||||| |||| ||||||||||||||||| |||||  |||||||||||||     
22347989 gttttggcaacaatggttagagatgtgttggccacaccagtatcatcagttgctt-tgaagagcgcatttagcactgggggaaggattttagacacatat 22348087  T
202 aggagctccttgagtccg 219  Q
    || ||||| |||||||||    
22348088 agaagctcattgagtccg 22348105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 83 - 197
Target Start/End: Complemental strand, 21281957 - 21281843
Alignment:
83 aaaatgaagtatgatattcagttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggagg 182  Q
    |||||||||| || |||||||||||||||  ||||||||||||||||||| ||||||  | ||||||  |||||  | |||||||||||||||  ||| |    
21281957 aaaatgaagtttgttattcagttttggcaataatggttagagattgtttgaccacacatgcgtcaacacttgctagtaaaagcgcatttagcataggaag 21281858  T
183 aagagttttagacac 197  Q
    ||| |||||| ||||    
21281857 aagggttttaaacac 21281843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 200
Target Start/End: Complemental strand, 17859927 - 17859863
Alignment:
136 acaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacata 200  Q
    ||||| || |||||||| ||||||||||| || |||||||||||||||||||||||||| |||||    
17859927 acaccagtttcaactgtggcttctgaaagtgcctttagcactggaggaagagttttagatacata 17859863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 103 - 217
Target Start/End: Original strand, 16000914 - 16001028
Alignment:
103 gttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacataca 202  Q
    ||||||||| ||||||||||||||   ||||||||||| || ||| | |||||||| || ||||||||||||||  | |||||  ||||||||||||| |    
16000914 gttttggcaacaatggttagagatgtgttggccacacctgtatcatcagttgcttcggagagcgcatttagcacccggggaaggattttagacacatata 16001013  T
203 ggagctccttgagtc 217  Q
    | ||||| |||||||    
16001014 gaagctcattgagtc 16001028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 200
Target Start/End: Complemental strand, 4968458 - 4968394
Alignment:
136 acaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacata 200  Q
    ||||| || |||||||| ||||||||||| || |||||||||||||||||||||||||| |||||    
4968458 acaccagtttcaactgtggcttctgaaagtgcctttagcactggaggaagagttttagatacata 4968394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 103 - 216
Target Start/End: Complemental strand, 306702 - 306589
Alignment:
103 gttttggcagcaatggttagagattgtttggccacaccggtgtcaactgttgcttctgaaagcgcatttagcactggaggaagagttttagacacataca 202  Q
    ||||||||| ||||||||||||||   ||||||||||| || ||| | ||| |||| || |||||||||||||| || |||||  |||||||| |||| |    
306702 gttttggcaacaatggttagagatgtcttggccacaccagtatcatcagtttcttcggagagcgcatttagcaccgggggaaggattttagacccatata 306603  T
203 ggagctccttgagt 216  Q
    ||||| | ||||||    
306602 ggagcccattgagt 306589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 387 times since January 2019
Visitors: 3834