View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_52 (Length: 286)
Name: NF0598_high_52
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_high_52 |
 |  |
|
[»] scaffold0250 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0250 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 29 - 257
Target Start/End: Complemental strand, 6958 - 6731
Alignment:
Q |
29 |
gtatgttgacaaacacgtatttctccgtttagatggcagcgatcacaacgtggtcgtctcaaatgtaatatcaatgtttcnnnnnnngattagctgataa |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||| |||||||| |||| |
|
|
T |
6958 |
gtatgttgacaaacacgtatttctccgtttagatggcagcaatcacaacgtggtcgcctcaaatgtaatatcaatgcttctttttttgattagctaataa |
6859 |
T |
 |
Q |
129 |
cggaggaagctcccgttgtcctcaagcactcaacatataaaaacatttgaaagctaacgcgccagaatttcatctttgtttttatctggtgtaacgggtt |
228 |
Q |
|
|
||||||||||||| |||||||||||||||||| ||||||||| ||| ||||||||||||||||| ||||||| |||||||| |||||||||||||||||| |
|
|
T |
6858 |
cggaggaagctcctgttgtcctcaagcactcatcatataaaa-catctgaaagctaacgcgccataatttcacctttgtttctatctggtgtaacgggtt |
6760 |
T |
 |
Q |
229 |
ttactgtgagattaagtttttaccttagc |
257 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
6759 |
ttactgtgagattaagtttttaccttagc |
6731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 242 - 286
Target Start/End: Complemental strand, 6717 - 6673
Alignment:
Q |
242 |
aagtttttaccttagcaatgttgtttggtttaatcgatgagtatc |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6717 |
aagtttttaccttagcaatgttgtttggtttaatcgatgagtatc |
6673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 951 times since January 2019
Visitors: 3838