View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_64 (Length: 251)
Name: NF0598_high_64
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_high_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 25540930 - 25541175
Alignment:
| Q |
1 |
gcaacttcagaaaggtgtcacagatttggaagaaaggaagcagaaagaagtatatgctaatagatatcaaaagaagactgatttcaaagacagaagagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25540930 |
gcaacttcagaaaggtgtcacagatttggaagaaaggaagcagaaagaagtatatgctaatagatatcaaaagaagactgatttcaaagatagaagagaa |
25541029 |
T |
 |
| Q |
101 |
tctaaaattgatattgaaagagaaaaagaatgcggagtttgcttggaggtgaaagcaaaagttgtgctgcctaattgttgccaccaaatgtgtttcaagt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25541030 |
tctaaaattgacattgaaagagaaaaagaatgcggagtttgcttggaggtgaaagcaaaagttgtgctgcctaattgttgccaccaaatgtgtttcaagt |
25541129 |
T |
 |
| Q |
201 |
gttacagagaatggtacatacaattcttcaattgcttcatctcact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25541130 |
gttacagagaatggtacatacaattcttcaattgcttcatttcact |
25541175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University