View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_66 (Length: 250)
Name: NF0598_high_66
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_high_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 38 - 245
Target Start/End: Original strand, 10011145 - 10011352
Alignment:
Q |
38 |
atggaagaaagaccaatcgaacctatgnnnnnnntatagaagagaggtgctcctgttttggagaattggacatnnnnnnntttcgttaaaaattatcttt |
137 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
T |
10011145 |
atggaagaaagaccaatcgaacctatgaaaaaaatatagaagagaggtgctcctgttttggagaattggacataaaaaattttccttaaaaattgtcttt |
10011244 |
T |
 |
Q |
138 |
ttgttctatattctttctcgtttctgaagcaaaagcgnnnnnnnnnnnnnnnnnnncgaagggagacaaaaatgatttagaagagttggacatcaaattc |
237 |
Q |
|
|
||||||||||||||||||||||||||||||| ||| | |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
10011245 |
ttgttctatattctttctcgtttctgaagcagaagagttatttttctttcctttttcgaagggagacataaatgatttagaagagttggacatcaaattc |
10011344 |
T |
 |
Q |
238 |
atatcagt |
245 |
Q |
|
|
|||||||| |
|
|
T |
10011345 |
atatcagt |
10011352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 77 - 164
Target Start/End: Original strand, 561565 - 561652
Alignment:
Q |
77 |
aagagaggtgctcctgttttggagaattggacatnnnnnnntttcgttaaaaattatctttttgttctatattctttctcgtttctga |
164 |
Q |
|
|
|||||||||| ||||||||||||||||||||||| |||| || |||||| || |||| |||||||||||||||||||||||| |
|
|
T |
561565 |
aagagaggtgttcctgttttggagaattggacatcaaattttttccttcaaaattgtccttttcttctatattctttctcgtttctga |
561652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1220 times since January 2019
Visitors: 3841