View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_7 (Length: 590)
Name: NF0598_high_7
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 548; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 548; E-Value: 0
Query Start/End: Original strand, 30 - 581
Target Start/End: Complemental strand, 10465641 - 10465090
Alignment:
Q |
30 |
tcttcatcactggagaattttgagctgaactatgattttttgcatggaattatacaggtcgtcagggaattgcaacattcaagaaatggtgttacggtga |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10465641 |
tcttcatcactggagaattttgagctgaactatgattttttgcatggaattatacaggtcgtcagggaattgcaacattcaagaaatggtgttacggtga |
10465542 |
T |
 |
Q |
130 |
tcacggaagatggttgtgtttacgaagccaattatgtgattctgtccgttagcattggcgttctccaaagtgacctacttgccttcaatccacccttacc |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10465541 |
tcacggaagatggttgtgtttacgaagccaattatgtgattctgtccgttagcattggcgttctccaaagtgacctacttgccttcaatccacccttacc |
10465442 |
T |
 |
Q |
230 |
agtacgttttctcaatacatattcttctcctttatttactctaaggagccccgtgtaatcaagcaagctagccgtagaatattgtatgatgtgggatgca |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10465441 |
agtacgttttctcaatacatattcttctcctttatttactctaaggagccccgtgtaatcaagcaagctagccgtagaatattgtatgatgtgggatgca |
10465342 |
T |
 |
Q |
330 |
tttattggtcccggatatgtggacacctcgtgcttctcacgctgatattttttaagctcattcattaatttgagaacttgccaccaacatggtgaaaatg |
429 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10465341 |
tttattggtcccggatatgtggacacctcgtgcttctcacgctgatattttttaagctcattcattaatttgagaacttgccaccaacatggtgaaaatg |
10465242 |
T |
 |
Q |
430 |
gaatctctaggtgttgttctttctgtctatacatacgggtcactacagcaggaatttcccttttgtggcccccaagtcttaaatattattggttgggaat |
529 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10465241 |
gaatctctaggtgtggttctttctgtctatacatacgggtcactacagcaggaatttcccttttgtggcccccaagtcttaaatattattggttgggaat |
10465142 |
T |
 |
Q |
530 |
gtaaagaaatgtagggatagctaggttttgtattaaatttgaggagtattat |
581 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10465141 |
gtaaagaaatgtagggatagctaggttttgtattaaatttgaggagtattat |
10465090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 86 times since January 2019
Visitors: 3831