View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_73 (Length: 219)
Name: NF0598_high_73
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_high_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 3641854 - 3641703
Alignment:
| Q |
1 |
aatttgattcttgcaacaacacgttggccaaattttgacttcatttataacttttga---------tacgatcctttctctctgtaaacactatatggtt |
91 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
3641854 |
aatttgattcttgtaacaacatgttggccaaattttgacttcatttataacttttgaaccttttgatacgatcctttctctctgtaaacattatatggtt |
3641755 |
T |
|
| Q |
92 |
agtctcttaaaattcattcagagtctgctgaattcagcaactgccctatgat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3641754 |
agtctcttaaaattcattcagagtctgctgaattcagcaactgccctctgat |
3641703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2716 times since January 2019
Visitors: 3823