View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_high_75 (Length: 205)
Name: NF0598_high_75
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_high_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 6111168 - 6111061
Alignment:
| Q |
1 |
atttggcttccatacatctatactatacatattcagctcatgaattaagtagtatagcatacaatagaaatttattaaagaacttgttaaagtaagtcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6111168 |
atttggcttccatacatctatactatacatattcagctcatgaattaagtagtatagcatacaatagaaatttcttaaagaacttgttaaagtaagtcaa |
6111069 |
T |
 |
| Q |
101 |
ttagatat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
6111068 |
ttagatat |
6111061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 82
Target Start/End: Complemental strand, 6249449 - 6249386
Alignment:
| Q |
21 |
tactatacatattcagctcatgaattaagtag--tatagcatacaatagaaatttattaaagaa |
82 |
Q |
| |
|
|||||| ||||||||||||||||||||| | | |||| ||||||||| ||| ||||||||||| |
|
|
| T |
6249449 |
tactatgcatattcagctcatgaattaacttgcatatatcatacaataaaaagttattaaagaa |
6249386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University