View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_19 (Length: 458)
Name: NF0598_low_19
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 1 - 448
Target Start/End: Original strand, 6299005 - 6299449
Alignment:
| Q |
1 |
aaacctcaagttttcttattgcagcttcagcctttgctttctgcaaactctcccatgcaatgattttagcttcatcatctctctcaaacctgcatcaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6299005 |
aaacctcaagttttcttattgcagcttcagcctttgctttctgcaaactctcccatgcaatgattttagcttcatcatctctctcaaacctgcgtcaaaa |
6299104 |
T |
|
| Q |
101 |
tgaaagttcatcgataaatacataaacacaacaatggattttccctcttttgttgactcaatgnnnnnnntgacaacatcaactatctaacatacttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
6299105 |
tgaaagttcatcgataaatacataaacacaacaatggattttccctcttttg---actcaatgaaaaagataagaacatcaactatctaacatacttgga |
6299201 |
T |
|
| Q |
201 |
actggaagtgtccgatgttatctctgcaatatccaaacctgaagcttctgtaccacttttctttaactccttaccattgaaagagcttagcttggatgca |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6299202 |
actggaagtgtccgatgttgtctctgcaatatccaaacctgaagcttctgtaccacttttctttaactctttaccattgaaagagcttagcttggatgca |
6299301 |
T |
|
| Q |
301 |
taactcttagaccaattaataacattagcctgacagtctatctgcacatctttgatctctaacttttctgaatggcaactttttggattcatggccaaaa |
400 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299302 |
taactcttagaccacttaataacattagcctgacagtctacctgcacatctttgatctctaacttttctgaatggcaactttttggattcatggccaaaa |
6299401 |
T |
|
| Q |
401 |
ttggggatgaagattttggagatgaatggtcttcattttcagtctctg |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299402 |
ttggggatgaagattttggagatgaatggtcttcattttcagtctctg |
6299449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2915 times since January 2019
Visitors: 3831