View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_23 (Length: 436)
Name: NF0598_low_23
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 128 - 425
Target Start/End: Complemental strand, 50761858 - 50761561
Alignment:
| Q |
128 |
ttgattattattgattgaaaatggcgggtgatagttgggtactgatggttactgctcagacaccaaccaacattgctgtgataaagtattggggtaaaag |
227 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761858 |
ttgattattattgattggaaatggcgggtgatagttgggtactgatggttacagctcagacaccaaccaacattgctgtgataaagtattggggtaaaag |
50761759 |
T |
 |
| Q |
228 |
agatgaaaccctaatcttacctgttaatgatagtatcagtgtcacgcttgatcccgctcatctttgcaccacaactaccgtttctgttagcccttccttt |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50761758 |
agatgaaaccctaatcttacctgttaatgatagtatcagtgtcactcttgatcccgctcatctttgcaccacaactaccgtttctgttagtccttccttt |
50761659 |
T |
 |
| Q |
328 |
caacaagatcgtatgtggctcaatggcaaggttgtttttccctctttttcaattttcaattcttaatgggatattggtgattaatttgttggattcat |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761658 |
caacaagatcgtatgtggctcaatggcaaggttgtttttccctctttttcaattttcaattcttaatgggatattggtgattaatttgttggattcat |
50761561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University