View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_36 (Length: 371)
Name: NF0598_low_36
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 31836432 - 31836232
Alignment:
| Q |
1 |
aatgatacaactccaagttctcttcttagccttgcaaactggtcagtcttcaaagcctttgtcaaaacatcagcaacttgcttattggcaggacagtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31836432 |
aatgatacaactccaagttctcttcttagccttgcaaactggtcagtcttcaaagcctttgtcaaaacataagcaacttgcttattggcaggacagtaag |
31836333 |
T |
 |
| Q |
101 |
ctactgtcaattcctacttctaaacttgcactctcagaaaatggaacctagtttcaatatgtttgctcctatcatgagatacaggattcttcgctaaatt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836332 |
ctactgtcaattcctacttctgaacttgcactctcagaaaatggaacctagtttcaatatgtttgctcctatcatgagatacaggattcttcgctaaatt |
31836233 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
31836232 |
t |
31836232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University