View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_43 (Length: 347)
Name: NF0598_low_43
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_43 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 98 - 311
Target Start/End: Complemental strand, 16803703 - 16803490
Alignment:
| Q |
98 |
gaggcatattcccaaggagatcttagtatagacactcttactttgaactctaataatgaccctcctatctcatttaaaaatattgtaataggatgcggcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16803703 |
gaggcatattcccaaggagatcttagtatagacactcttactttgaactctaataatgacactcctatctcatttaaaaatattgtaataggatgcggcc |
16803604 |
T |
|
| Q |
198 |
atagaaataagggtccacttgagggatatgtatccggaaatattggtcttggacgtggacctttgtcttttatatcccaattgaattcttcgattggtgg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16803603 |
atagaaataagggtccacttgagggatatgtatccggaaatattggtcttggacgtggacctttgtcttttatatcccaattgaattcttcgattggtgg |
16803504 |
T |
|
| Q |
298 |
aaaattttcatatt |
311 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16803503 |
aaaattttcatatt |
16803490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 104 - 311
Target Start/End: Original strand, 19573546 - 19573753
Alignment:
| Q |
104 |
tattcccaaggagatcttagtatagacactcttactttgaactctaataatgaccctcctatctcatttaaaaatattgtaataggatgcggccatagaa |
203 |
Q |
| |
|
||||| |||||||||||| || | ||||||||||||||||||||||| |||| | ||||||||||||| ||||||||||| || ||||| || ||||||| |
|
|
| T |
19573546 |
tattcgcaaggagatcttggtgtcgacactcttactttgaactctaacaatggcactcctatctcattcaaaaatattgtgattggatgtgggcatagaa |
19573645 |
T |
|
| Q |
204 |
ataagggtccacttgagggatatgtatccggaaatattggtcttggacgtggacctttgtcttttatatcccaattgaattcttcgattggtggaaaatt |
303 |
Q |
| |
|
|| |||| ||| | ||||| ||||| || ||||||||||| |||| ||| || |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19573646 |
atcaggggccattagaggggtatgtctcaggaaatattggccttgcacgcgggcctttgtcttttatatcccaattgaattcttcaattggtggaaaatt |
19573745 |
T |
|
| Q |
304 |
ttcatatt |
311 |
Q |
| |
|
||| |||| |
|
|
| T |
19573746 |
ttcttatt |
19573753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 311
Target Start/End: Complemental strand, 15237 - 15172
Alignment:
| Q |
246 |
ttggacgtggacctttgtcttttatatcccaattgaattcttcgattggtggaaaattttcatatt |
311 |
Q |
| |
|
||||||| |||||||| || || ||||| ||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
15237 |
ttggacgcggacctttatcgttaatatctcaattgagttcttcgattaatggaaaattttcttatt |
15172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 438 times since January 2019
Visitors: 3834