View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_45 (Length: 341)
Name: NF0598_low_45
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 94 - 330
Target Start/End: Complemental strand, 45634964 - 45634727
Alignment:
| Q |
94 |
aaacacaactcaatgcttgctttttctc--cataatgagatgagaacaaagatataaaatttcat-aatttcttacattaatattattaatatgacagtg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
45634964 |
aaacacaactcaatgcttgctttttctctccataatgagatgagaacaaagatataaaatt--atcaatttcttacattaatattattaatatgacagtg |
45634867 |
T |
|
| Q |
191 |
tttctctatggggctatacacactgtggatgaagttgcagcaagtgattacatctcctgcaccactggaaatccaattagttcagacaatagtggtgaga |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45634866 |
tttctctatggggctatacacactgtggatgaagttgcagcaagtgactacatctcctgcaccactggaaatccaattagttcagacaatagtggtgaga |
45634767 |
T |
|
| Q |
291 |
caaccatagctcttaagactgcaggaactcattatttcat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45634766 |
caaccatagctcttaagactgcaggaactcattatttcat |
45634727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1050 times since January 2019
Visitors: 3839