View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0598_low_52 (Length: 323)

Name: NF0598_low_52
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0598_low_52
NF0598_low_52
[»] chr5 (1 HSPs)
chr5 (30-87)||(38441725-38441784)


Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 38441725 - 38441784
Alignment:
30 agtttatggggttaaagatcaaggat--ctatgagttgatgatagaaatatcattacaaa 87  Q
    |||||||| | |||||||||||| ||  ||||||||||||||||||||||||||||||||    
38441725 agtttatgagcttaaagatcaagaatatctatgagttgatgatagaaatatcattacaaa 38441784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University