View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_52 (Length: 323)
Name: NF0598_low_52
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 38441725 - 38441784
Alignment:
Q |
30 |
agtttatggggttaaagatcaaggat--ctatgagttgatgatagaaatatcattacaaa |
87 |
Q |
|
|
|||||||| | |||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
T |
38441725 |
agtttatgagcttaaagatcaagaatatctatgagttgatgatagaaatatcattacaaa |
38441784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University