View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_54 (Length: 317)
Name: NF0598_low_54
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 28 - 221
Target Start/End: Complemental strand, 1413028 - 1412833
Alignment:
| Q |
28 |
ttcttagcattatccgcttaattgtatggtac--cccagtgttctatttaattttcttcttccctggtcgattaatcataccaaacatttctagtcaaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1413028 |
ttcttagcattatccgcttaattgtatggtacaccccagtgttctatttaattttcttcttccctggtcgattaatcataccaaacatttctagtcaaat |
1412929 |
T |
 |
| Q |
126 |
ctcaatttttaagcaatgatcacagattctatatccaaagtaaaggctagagtataaaatgaagtaggttaccaacgtttaatgtaaatgacttat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1412928 |
ctcaatttttaagcaatgatcacagattctatatccaaagtaaaggctagagtataaaatgaagtaggttaccaacgtttaatgtaaatgacttat |
1412833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University