View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_62 (Length: 308)
Name: NF0598_low_62
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 30 - 231
Target Start/End: Original strand, 31486127 - 31486328
Alignment:
| Q |
30 |
gagaaggttggttaatcccacgcatcttcaaccttttctcaatctctccatagatcaaatcattgtgctttggttcagggaagaaatcagtagagtcgta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31486127 |
gagaaggttggttaatcccacgcatcttcaaccttttctcaatctctccatagatcaaatcattgtgctttggttcagggaagaaatcagtagagtcgta |
31486226 |
T |
 |
| Q |
130 |
gaaactcttcttttgcaccatcattgttcccttattctgcttccctcttcctccttccacacctctaccattccataatccattatcaatgttaccataa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31486227 |
gaaactcttcttttgcaccatcattgttcccttattctgcttccctcttcctccttccacacctctaccattccacaatccattatcaatgttaccataa |
31486326 |
T |
 |
| Q |
230 |
ga |
231 |
Q |
| |
|
|| |
|
|
| T |
31486327 |
ga |
31486328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 43 - 75
Target Start/End: Complemental strand, 38446742 - 38446710
Alignment:
| Q |
43 |
aatcccacgcatcttcaaccttttctcaatctc |
75 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
38446742 |
aatcccacgcatcttcaaccgtttctcaatctc |
38446710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University