View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_63 (Length: 293)
Name: NF0598_low_63
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_low_63 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 293
Target Start/End: Original strand, 10010702 - 10010962
Alignment:
Q |
30 |
tcaagcatcttaactttgctttgctctctatatcaaacattggatgtgaacaattctcatattcttatgcaccatattcaagcaaacttgaatgtcatta |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10010702 |
tcaagcatcttaactttgctttgctctctatattaaacattgga---gaacaattctcatattcttatgcaccatattcaagcaaacttgaatgtcatta |
10010798 |
T |
 |
Q |
130 |
gattagactcatggcaacatcataaattaaatcaacaaattaaagaacgtaattagcaaccactgacattaaatccaaacattccgttctcactgacaac |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
T |
10010799 |
gattagactcatggcaacatcataaattaaatcaacaaattaaagaacgtaattagcaaccactgacactaaatccaaactttccgttctcactgacaac |
10010898 |
T |
 |
Q |
230 |
agccatcacgcacaacgcgcagatactctaatattcagaaaaacaattttaacacctgttgaac |
293 |
Q |
|
|
|||| ||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
10010899 |
agccgtcacgcacaacgctcagatactctaatattcagagaaacaattttaaaacctgttgaac |
10010962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3050 times since January 2019
Visitors: 3831