View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_66 (Length: 286)
Name: NF0598_low_66
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 9 - 110
Target Start/End: Complemental strand, 38608708 - 38608607
Alignment:
Q |
9 |
gattattcttgctgtagggatagtagcatgtgcgatattattctcaaaattatcggtgaaagacaattcattttaggttgaagttgtgaaacaaagtatt |
108 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38608708 |
gattattcttgcagtagggatagtagcatgtgcgatattattctcaaaattatcagtgaaagacaattcattttaggttgaagttgtgaaacaaagtatt |
38608609 |
T |
 |
Q |
109 |
gt |
110 |
Q |
|
|
|| |
|
|
T |
38608608 |
gt |
38608607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 166 - 258
Target Start/End: Complemental strand, 38608495 - 38608402
Alignment:
Q |
166 |
aaatagattcgtgatttacacctttaaaattcactttagaactactc-tttcttaattttctttatctctcattttcaatagatggtgaaaatt |
258 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38608495 |
aaatagattcgtgatttacacctttaaaattcactttagaactactcttttcttaattttctttatctctcattttcaatagatggtgaaaatt |
38608402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 150
Target Start/End: Complemental strand, 38608553 - 38608514
Alignment:
Q |
111 |
aattctcaacctcttgaatcattgttcctaataattgtga |
150 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
38608553 |
aattctcaacctcttgaatcattgttcctaatagttgtga |
38608514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 533 times since January 2019
Visitors: 3835