View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0598_low_66 (Length: 286)

Name: NF0598_low_66
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0598_low_66
NF0598_low_66
[»] chr3 (3 HSPs)
chr3 (9-110)||(38608607-38608708)
chr3 (166-258)||(38608402-38608495)
chr3 (111-150)||(38608514-38608553)


Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 9 - 110
Target Start/End: Complemental strand, 38608708 - 38608607
Alignment:
9 gattattcttgctgtagggatagtagcatgtgcgatattattctcaaaattatcggtgaaagacaattcattttaggttgaagttgtgaaacaaagtatt 108  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
38608708 gattattcttgcagtagggatagtagcatgtgcgatattattctcaaaattatcagtgaaagacaattcattttaggttgaagttgtgaaacaaagtatt 38608609  T
109 gt 110  Q
    ||    
38608608 gt 38608607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 166 - 258
Target Start/End: Complemental strand, 38608495 - 38608402
Alignment:
166 aaatagattcgtgatttacacctttaaaattcactttagaactactc-tttcttaattttctttatctctcattttcaatagatggtgaaaatt 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38608495 aaatagattcgtgatttacacctttaaaattcactttagaactactcttttcttaattttctttatctctcattttcaatagatggtgaaaatt 38608402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 150
Target Start/End: Complemental strand, 38608553 - 38608514
Alignment:
111 aattctcaacctcttgaatcattgttcctaataattgtga 150  Q
    ||||||||||||||||||||||||||||||||| ||||||    
38608553 aattctcaacctcttgaatcattgttcctaatagttgtga 38608514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 533 times since January 2019
Visitors: 3835