View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_69 (Length: 267)
Name: NF0598_low_69
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 51728128 - 51727903
Alignment:
| Q |
19 |
ctctatcattcattttggttcacagttaatccttccatatccattacttggacagggagtttaatttaatggttcggtttttagtaaaaaataaataaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51728128 |
ctctatcattcattttggttcacagttaatccctccatatccattacttggacaggggg-----tttaatggttcggtttttagtaaaaaataaataaat |
51728034 |
T |
 |
| Q |
119 |
atccaagtttaacaaatctacatcgatttgtctagaaatccaagcttagaggacaaatgctgttcacgagctttgtcaaaaatagtaaaaatacatatct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51728033 |
atccaagtttaacaaatctacatcgatttgtctagaaatcctagcttagaggacaaatgctgttcacgagctttgtcaaaaatagtaaaaatacatatct |
51727934 |
T |
 |
| Q |
219 |
actcgaagatacattgttcacgagctttcaa |
249 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
51727933 |
actccaagatacattgttcacgagctttcaa |
51727903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University