View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_71 (Length: 257)
Name: NF0598_low_71
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 72 - 169
Target Start/End: Complemental strand, 51728672 - 51728575
Alignment:
| Q |
72 |
ttaccttcgtattgaacaactctagctggaataccgaatgaattaatattttcactatcttcccatcttactttaatcttaatccgataccatctata |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51728672 |
ttaccttcgtattgaacaactctagctggaataccgaatgaattaatattttcactatcttcccatcgtactttaatcttaatccgataccatctata |
51728575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 160 times since January 2019
Visitors: 3831