View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_73 (Length: 252)
Name: NF0598_low_73
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 9 - 167
Target Start/End: Original strand, 43082602 - 43082760
Alignment:
| Q |
9 |
agcacagacacaatgtagtaggtcttagccatgaaacactaactcagttccggtcatggttgttgtgactaattttatgagcatcttgtgcattctgtca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082602 |
agcacagacacaatgtagtaggtcttagccatgaaacactaactcagttccggtcatggttgttgtgactaattttatgagcatcttgtgcattctgtca |
43082701 |
T |
|
| Q |
109 |
atccgttaacaaatggctatacctcgatctgtcgcaaacagacaggcagcaactctaat |
167 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082702 |
atccgttaacaaaaggctatacctcgatctgtcgcaaacagacaggcagcaactctaat |
43082760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2187 times since January 2019
Visitors: 3815