View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_76 (Length: 251)
Name: NF0598_low_76
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_low_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6881235 - 6881458
Alignment:
Q |
1 |
atattaagaggatttgagtaccaggacagagatatttcctagttctcttaacgatggaggcacatttacaatttttgtgacctgtttgtatgcttagtta |
100 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
6881235 |
atattaagaggatttgagtaccaggacggagatatttcctagttctcttaatgatggaggcacatttacaatttttgtgaactgtttgtatgcttagtta |
6881334 |
T |
 |
Q |
101 |
gattttcggtttgttctcattgtcaattcagtcattgcaattgt-gaaatgannnnnnnnnnnnnnnngctgccacagagaattctccatagtattcttg |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
6881335 |
gattttcggtttgttctcattgtcaattcagtcattgcaattgtggaaatgatttttatttttattttgctgccacagagaattctccatagtattcttg |
6881434 |
T |
 |
Q |
200 |
agtaaaagagattatgagcagagt |
223 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
6881435 |
agtaaaagagattatgagcagagt |
6881458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 115
Target Start/End: Original strand, 6845715 - 6845765
Alignment:
Q |
65 |
tttacaatttttgtgacctgtttgtatgcttagttagattttcggtttgtt |
115 |
Q |
|
|
|||||||| || |||| |||||||||||||||||||| ||||| ||||||| |
|
|
T |
6845715 |
tttacaatcttcgtgaactgtttgtatgcttagttaggttttcagtttgtt |
6845765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 35458354 - 35458386
Alignment:
Q |
1 |
atattaagaggatttgagtaccaggacagagat |
33 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |
|
|
T |
35458354 |
atattaagaggatttgagtaccaggacggagat |
35458386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2336 times since January 2019
Visitors: 3818