View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_89 (Length: 230)
Name: NF0598_low_89
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 31836408 - 31836627
Alignment:
| Q |
1 |
gaagagaacttggagttgtatcatttttgttgtgattttgtattaagggatggtgttgtaagtaatacgaaaccaattcagtttttacagttagtaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836408 |
gaagagaacttggagttgtatcatttttgttgtgattttgtattaagggatggtgttgtaagtaatacgaaaccaattcagtttttacagttagtaattc |
31836507 |
T |
 |
| Q |
101 |
agttagtgtaactgataatttgttacatagcagttcatataaataagtactagttgcactatgtagtatttgtgagaaattaataaaagttctcaagctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
31836508 |
agttagtgtaactgataatttgttacatagcagttcatataaataagtactagttgcactatgtagtgtgtgtgagaaattaataaaagttctcaagctt |
31836607 |
T |
 |
| Q |
201 |
ccctaatctctttctctctg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31836608 |
ccctaatctctttctctctg |
31836627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University