View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0598_low_94 (Length: 204)

Name: NF0598_low_94
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0598_low_94
NF0598_low_94
[»] chr4 (1 HSPs)
chr4 (74-104)||(27612801-27612831)


Alignment Details
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 104
Target Start/End: Complemental strand, 27612831 - 27612801
Alignment:
74 atcatccatggatgttaacaaactcttcagc 104  Q
    |||||||||||||||||||||||||||||||    
27612831 atcatccatggatgttaacaaactcttcagc 27612801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University