View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_95 (Length: 203)
Name: NF0598_low_95
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_low_95 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 112 - 190
Target Start/End: Complemental strand, 13744713 - 13744636
Alignment:
Q |
112 |
tttggttgaattccggtaatcatattaatttgctagtcctgcagttctatgcatactaaaactcaggtaccagttacct |
190 |
Q |
|
|
|||||||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
T |
13744713 |
tttggttgaattccagtaatca-attaatttgctagtcctacatttctatgcatactaaaactcaggtaccagttacct |
13744636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 13744777 - 13744710
Alignment:
Q |
24 |
tataatcatcaatgaaaatatcagaacccacatgagatgctaaggtggaaggaacacacaataatttg |
91 |
Q |
|
|
||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
13744777 |
tataatcatcaataaaaatatcagatcccacaatagatgctaaggtggaaggaacacacaataatttg |
13744710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1368 times since January 2019
Visitors: 3846