View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_96 (Length: 202)
Name: NF0598_low_96
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0598_low_96 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 13744636 - 13744713
Alignment:
| Q |
20 |
aggtaactggtacctgagttttagtatgcatagaactgcaggactagcaaattaatatgattaccggaattcaaccaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
13744636 |
aggtaactggtacctgagttttagtatgcatagaaatgtaggactagcaaattaat-tgattactggaattcaaccaaa |
13744713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 119 - 186
Target Start/End: Original strand, 13744710 - 13744777
Alignment:
| Q |
119 |
caaattattgtgtgttccttccaccttagcatctcatgtgggttctgatattttcattgatgattata |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||| |
|
|
| T |
13744710 |
caaattattgtgtgttccttccaccttagcatctattgtgggatctgatatttttattgatgattata |
13744777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 759 times since January 2019
Visitors: 3837