View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0598_low_97 (Length: 201)
Name: NF0598_low_97
Description: NF0598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0598_low_97 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 14 - 92
Target Start/End: Original strand, 13744636 - 13744713
Alignment:
Q |
14 |
aggtaactggtacctgagttttagtatgcatagaactgcaggactagcaaattaatatgattaccggaattcaaccaaa |
92 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||| |||||||||||||| |
|
|
T |
13744636 |
aggtaactggtacctgagttttagtatgcatagaaatgtaggactagcaaattaat-tgattactggaattcaaccaaa |
13744713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 113 - 180
Target Start/End: Original strand, 13744710 - 13744777
Alignment:
Q |
113 |
caaattattgtgtgttccttccaccttagcatctcatgtgggttctgatattttcattgatgattata |
180 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||| |
|
|
T |
13744710 |
caaattattgtgtgttccttccaccttagcatctattgtgggatctgatatttttattgatgattata |
13744777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University