View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_18 (Length: 434)
Name: NF0599_high_18
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0599_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 48 - 424
Target Start/End: Original strand, 36791090 - 36791471
Alignment:
Q |
48 |
cataattacaagcaaaagctctacggatcatataagtcattacattagtagcagctgcaaagttaaagggcatcttcaaacctcaaccatgcaaacagtc |
147 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
36791090 |
cataactacaagcaaaagctctacggatcatataagtcattacattagtagcagctgcaaagttaaagggcatcttcaaacctcaaccatgcaagcagtc |
36791189 |
T |
 |
Q |
148 |
atgagtgtgaatctggtggtttttgattcctggattgtatgtaattggtgatccaatacttcagtgatgaggctttcatcccaaaataagtggttttagg |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
36791190 |
atgagtgtgaatctggtggtttttgattcctggattgtatgtaattggtgatccaatacttaagtgatgaggctttcatcccaaaataagtggttttagg |
36791289 |
T |
 |
Q |
248 |
tggggatgaggatgagggtggcagggtcattgatgatcttccataatattgagggagcaaaagcattgctgcagtaggtgccattgagaat--------- |
338 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36791290 |
tgg------ggatgagggtggcagggtcattgatgatcttccataatattgagggagcaaaagcattgctgcagtaggtgccattgagaataagttaaaa |
36791383 |
T |
 |
Q |
339 |
--taaaatgggttaatcaaacaacattcacattatatgtagagagagacactagaagtagtggttgggataagcataaatagtctgtg |
424 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36791384 |
agtaaaatgggttcatcaaacaacattcacattatatgtagagagagacactagaagtagtggttgggataagcataaatagtctgtg |
36791471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1230 times since January 2019
Visitors: 3841