View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0599_high_40 (Length: 320)
Name: NF0599_high_40
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0599_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 30 - 314
Target Start/End: Original strand, 23812308 - 23812606
Alignment:
| Q |
30 |
atcacaagtcagactctcaactctccacagaatacattataaacaccacacaattctaaccttgtagaagccaaaatattgagatgaaaatcttcaatac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23812308 |
atcacaagtcagactctcaactctccacagaatacattataaacaccacacaattctaaccttgtagaagccaaaatattgagatgaaaatcttcaatac |
23812407 |
T |
|
| Q |
130 |
tt--------------gaacttcaagacttgaacttctgtcaaatgagttcaaactcaaccttccaaaccttccggaacactaacatcaccctgaacttc |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23812408 |
ttgaacttcaagacttgaacttcaagacttgaacttctgtcaaatgagttcaaactcaaccttccaaaccttccggaacactaacatcaccctgaacttc |
23812507 |
T |
|
| Q |
216 |
aactcttactactacttggtggtgtcttcattatgacacttttattacttcattcttgtcttcaacacaatactcttattacttcattcttgtcttcaa |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23812508 |
aactcttactactacttggtggtgtcttcattatgacacttttattacttcattcttgtcttcaacacaatactcttattacttcattcttgtcttcaa |
23812606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1308 times since January 2019
Visitors: 3844