View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0599_high_42 (Length: 301)

Name: NF0599_high_42
Description: NF0599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0599_high_42
NF0599_high_42
[»] chr8 (1 HSPs)
chr8 (29-301)||(1329715-1329985)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 29 - 301
Target Start/End: Complemental strand, 1329985 - 1329715
Alignment:
29 attaatatcaatagttttattagtatattaaacttt-gcgaaatggctagtttctcataatatagtgaatcgatgtttgaatgccgatttaaaatgctca 127  Q
    |||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||| || ||||||||||    
1329985 attaatatcaatagttttattagtatattaaacttttgcgaaagggttagtttctcataatatagtgaatcgatgtttgaatgccggttgaaaatgctca 1329886  T
128 taattaatagttaaattaatgtgtctcgaacaagattatcttcaacgaagaaaatcc-nnnnnnnnnttgcaagcataggaaatgctgcatcatgcatgt 226  Q
    |||||||||||||    |||||||||||||||||||||  ||  || ||||||||||          ||||||||||| |||||||||||||||||||||    
1329885 taattaatagtta----aatgtgtctcgaacaagattacttttgaccaagaaaatccaaaaaaaaaattgcaagcataagaaatgctgcatcatgcatgt 1329790  T
227 ggttttgcaaatttgggtcacattgaaaacagggaccacatatccacattctcaatcacatggaatgttgccaaa 301  Q
    |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
1329789 ggttgtgcaaatttgggtcacattgaaaacagcgaccacatatccacattctcaatcacatggaatgttgccaaa 1329715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 887 times since January 2019
Visitors: 3837